成功案例

Figure 1. Comparison of the specificity between LiQuant? Ultra and Brand N

Template DNA: Eight 10×Dilutes of the pET28a plasmid with Bacillus badius phenylalanine dehydrogenase gene.

Primer: Forward primer AGGAAGCCGATGTGTTCGTT        Reverse primer TTCCGCTTGCTGGTACACTT

From the melting curve, it shows that LiQuant? Ultra exhibits a single peak under both low and high concentration templates, while under low concentration templates, Brand N exhibits non-specific amplification.

Figure 2. High stability verification

Template DNA: Eight 10×Dilutes of the pET28a plasmid with Bacillus badius phenylalanine dehydrogenase gene.

Primer: Forward primer AGGAAGCCGATGTGTTCGTT        Reverse primer TTCCGCTTGCTGGTACACTT

From the amplification curve, it shows that the LiQuant? stored at 37 ℃ and at -20 ℃ have the same curve, and the Cq value is basically similar. From the standard curve, it shows that the PCR efficiency of LiQuant? at different stored temperatures are both at 95% -100%, and the R2 value is 0.999.